Inspiring words from Barack Obama’s Presidential Inauguration Speech, 2009:

“We will restore science to its rightful place and wield technology’s wonders to raise health care’s quality … and lower its costs.

We will harness the sun and the winds and the soil to fuel our cars and run our factories. And we will transform our schools and colleges and universities to meet the demands of a new age.

All this we can do. All this we will do." – Barack Obama

Yes we will … faithfully. – MS

Too often, geographic boundaries separate what is possible and what is not in scientific research. Often this is due to the economic situation of individual countries, universities, or individuals. This divide is particularly evident in some developing countries, where needed scientific resources are often lacking, or difficult to obtain. Earlier this month Cell had a feature article on a new initiative of the New York Academy of Sciences called Scientists Without Borders.

At its core, Scientists Without Borders aims to partner scientists in the developed world with those in developing countries. Such collaboration can be of great benefit to all parties involved, and I am optimistic that scientific networking websites like Scientists Without Borders and Nature Network will help lead us into an era fostering increased international communication, collaboration, and scientific progress, connecting individuals across geographic, as well as economic boundaries.

Lights out for Earth Hour

I spent two days last week attending the Harvard Radcliffe Origins of Life symposium

The first day highlighted scientists from Harvard, while the second day featured outside experts. Scientists from many diverse disciplines (astronomy, chemistry, biology, geology, etc) converged to discuss topics ranging from how to find other potentially habitable planets (Sara Seager, MIT) , to discussions and experiments aimed at giving us a better idea how life’s first precursors and polymers may have formed, replicated, or even become encapsulated .

For me, some of the highlights included Jack Szostak’s (Harvard) discussions of replicating vesicles (models for early cells or cell divisions), and Gerald Joyce’s (Scripps) work on RNA ribozymes (as a model for simple self-replicating systems).

Immersed in a sea of scientists, I was somewhat surprised to see a priest walk by me toward the end of the conference. I guess he probably spends a lot of time thinking about the origins of life too.

Last month I sat in the Biomass-to-Biofuels Session at the AAAS annual meeting here in Boston.

There I saw a talk by one of my former PhD graduate committee members, Jim Liao (UCLA), who talked about his recent work focusing on reengineering the bacterium E. coli to produce butanol from simple sugars.

It’s quite astounding the possibilities that abound when you realize the potential that genetic engineering and synthetic biology provide. Engineering new pathways in microorganisms has come a long way and continues to make great strides in applications ranging from biofuels to medicine.

I’m glad that funding agencies (both private and public) are now taking a more active role in funding sustainable and renewable bioenergy research projects in this time of needed innovation.

The Microbial Science Initiative (MSI) chalktalk seminar series is truly a gem among the many seminars at Harvard, particularly if you are interested in the microbial world. Leave your powerpoint at the door.
http://www.msi.harvard.edu/fridays.html

Here’s also a nice article about the Microbial Science Initiative: The Undiscovered Planet, Harvard Magazine 2007

I wonder sometimes if the somewhat high fees associated with downloading electronic reprints of scientific articles, which in some cases range from $10 to $30 per article, stifle not only the dissemination of science but also the speed and progress of science.

While most scientists at large research universities have institutional subscriptions to many journals, and therefore don’t have to pay extra fees to download individual articles, the majority of the general public does not have this same type of access due to the somewhat high costs associated with institutional and personal journal subscriptions.

In the day of google and wikipedia, individuals are becoming less reliant on “experts” relaying information to them, and are instead investigating and researching questions themselves, with the help of their trusted computer. While individuals can get much useful information from internet search sites and web-based encyclopedias, why should they also not be able to read the latest full-length, peer-reviewed scientific articles, without the fear of going broke pursuing their natural curiosity?

For instance, why should a newly-diagnosed cancer patient be economically discouraged from reading the latest scientific research regarding their certain type of cancer, due to the high costs of electronic reprints?

or

Why shouldn’t a high school student be encouraged to download 5 recent papers related to a particular scientific topic for a mere fee of $1 each? Something that would surely be cost prohibitive at a cost of $10 to $30 each.

Research is published in hundreds, if not thousands, of diverse journals, making personal subscriptions to all of these extremely cost prohibitive to someone in the general public, and the fee for individual scientific article reprints too costly at this time I believe.

To address this need, I’d like for someone to develop (with the publishers) an easily searchable database (in the vein of NCBI’s PubMed), that not only allowed users to freely search and identify relevant scientific articles, but also allowed users to download complete electronic reprints of the articles for $1 or less. Such a model has worked well in the music industry (case in point Apple iTunes) and I sincerely believe that such a model could greatly expand the reach of science in both the worldwide scientific community as well as the general public at large.

Journals may at first be wary of such a proposal, envisioning shrinking profit margins and unsustainable models, but I believe that if the price of scientific reprints were decreased to $1, a model of high price/small market would be gradually replaced with a model of low price/larger market. It’s important for all of us to maintain the journals economic strength and viability, since they are the main source we use to share our scientific work with others, as well as for us to learn about the most current research.

Another complementary model I support, adopted by the open access journals, is to make all articles free of charge, supplemented by author fees or outside grants. Such models are complementary to the $1 reprint, since the end goal is to make scientific literature more accessible to a wider audience. Some journals will thrive under the open access model, while others may need a continued revenue source to maintain viability, but in the end it is important to decrease the fees for scientific reprints to a nominal fee.

I look forward to the day, where anyone can sit down at their computer and download any scientific article for $1 or less.

Sometimes events happen that shake people up a bit, to the reality that disease has no borders. Such has happened recently, in the case of Andrew Speaker, the individual diagnosed with extensively drug resistant (XDR) tuberculosis. Speaker drew attention to himself due not only because of the rarity of his highly drug resistant strain of tuberculosis (XDR), but also for his disregard for others as he traveled by plane back to North America.

Bacteria have been evolving for billions of years, so it should not be surprising to us that they continue to evolve in modern times. The same selective forces that have helped bacteria adapt to particular niches and environments are now enabling bacteria to become resistant to drugs and antibiotics at a disturbing rate. Add to that, the challenge, cost, and time involved in identifying new drugs and new drug targets, and this problem becomes even more worrisome.

Such cases have emphasized the need to develop faster and better methods to identify new and more effective drugs, alternative strategies to fight bacterial and viral diseases, and better vaccine platforms. In some cases we must rethink traditional methods of fighting disease if we really want to keep up with the readily evolving drug resistant strains.

Presently, more than 2 million people die from tuberculosis each year. Many of these cases are in countries where they do not have adequate access to costly drugs. I hope in the coming years that academic labs, biotech companies, and pharmaceutical companies can pull together to work toward better solutions for combating disease at home and abroad. At home, the challenge will be to deal with emerging multi-drug resistant strains, and abroad the challenge will be to make drugs cheap enough so that all who need these drugs will get them, no matter the economic background. These are worldwide problems that need worldwide solutions.

A few weeks ago I attended the annual “Second Year Show” put on by the second year Medical School and Dental School students at Harvard.

It was a great show, and I really have to give it up for the second year HMS and HSDM students. They really put in a lot of effort and did a great job.

This year’s show titled “Joseph Martin and the Amazing Technicolor White Coat”, featured a cast of students parodying select HMS professors (all in fun), who by day seemed to be mild-mannered professors, but when a dire situation arose on stage, they donned their spandex-superhero costumes to battle the diseases that be. The characters ranged from Captain Tight Junctions to Joseph “Dean” Martin.

Some of the notable performances included the over-eager surgeons-to-be, the cast of students playing diseases (ranging from TB to Staph), M&M (the rapping Morbidity and Mortality antagonist), and of course the HMS superheroes.

The show also featured musical and dance numbers throughout, many of which centered on science, medicine, or curriculum reform. With lyrics like the following how could you not love the show:

“Look at this bench,
Isn’t it grand?
Wouldn’t you want a pipette in your hand?”

The show was fun, and I would recommend next years show to anyone living in the Boston area, particularly if you work in science or medicine.

The other day I went to a seminar at MIT given by Francis Collins. I, and many others, know Francis Collins for the important role he played in pushing forward the public human genome sequencing project, a research project that is likely one of the most important projects in the history of science.

The seminar at MIT was not your traditional seminar by any means, but instead featured Dr. Collins discussing his faith, of all things, within the context of his work. It was part of the Veritas Forum at MIT, discussing Science, Faith, and Technology. I had not been to a seminar like this before.

There were many topics discussed that I will not go into, but one in particular that I did appreciate. It was a discussion of the overwhelming evidence that evolution happens.

Somewhere along the line, evolution became a bad word to many religions. In turn, it has closed many people’s minds, and created an unnecessary anxiety that if evolution happens then maybe certain religious foundations would crumble. I appreciated that Francis Collins, in his own way, was trying to help others understand that, yes, evolution does happen, that there is overwhelming evidence that evolution happens, and, yes, evolution has shaped all life forms on earth, including ourselves.

As I said in my first blog:
ATGATTAACTCCTGTATAGAAAATTGTGAAGCCAGGGAGACCCATGAAG
CAAATTCATGGGAGAGATCGTGA
Translated: In Science are the Answers

I personally think the study of evolution is one of the most fascinating areas of science, and with the abundance of genomes now available, we can really begin to better probe how life evolved at the molecular, cellular, and organismal level.

The last question of the night from the audience, was the best question of all. If life has been evolving for billions of years, why do we think that we (humans) are the endpoint?

I started writing a book on this question today.