• The Evolution Continuum

      Sunday, 04 Mar 2007 - 05:37 GMT

      The other day I went to a seminar at MIT given by Francis Collins. I, and many others, know Francis Collins for the important role he played in pushing forward the public human genome sequencing project, a research project that is likely one of the most important projects in the history of science.

      The seminar at MIT was not your traditional seminar by any means, but instead featured Dr. Collins discussing his faith, of all things, within the context of his work. It was part of the Veritas Forum at MIT, discussing Science, Faith, and Technology. I had not been to a seminar like this before.

      There were many topics discussed that I will not go into, but one in particular that I did appreciate. It was a discussion of the overwhelming evidence that evolution happens.

      Somewhere along the line, evolution became a bad word to many religions. In turn, it has closed many people’s minds, and created an unnecessary anxiety that if evolution happens then maybe certain religious foundations would crumble. I appreciated that Francis Collins, in his own way, was trying to help others understand that, yes, evolution does happen, that there is overwhelming evidence that evolution happens, and, yes, evolution has shaped all life forms on earth, including ourselves.

      As I said in my first blog:
      ATGATTAACTCCTGTATAGAAAATTGTGAAGCCAGGGAGACCCATGAAG
      CAAATTCATGGGAGAGATCGTGA
      Translated: In Science are the Answers

      I personally think the study of evolution is one of the most fascinating areas of science, and with the abundance of genomes now available, we can really begin to better probe how life evolved at the molecular, cellular, and organismal level.

      The last question of the night from the audience, was the best question of all. If life has been evolving for billions of years, why do we think that we (humans) are the endpoint?

      I started writing a book on this question today.

      Last updated: Sunday, 04 Mar 2007 - 05:37 GMT

      • Comments

        • Date:
          Thursday, 08 Mar 2007 - 02:50 GMT
          Subramanian Kanagarajan said:

          Futurists discuss transhumanism and the law of increasing returns which eventually is said to lead to a singularity.
          I think the rate of evolution is/has been increasing. If humans start tampering with the genetic pool, the mutations might have a direction apart from just survival.

        • Date:
          Thursday, 08 Mar 2007 - 09:43 GMT
          Henry Gee said:

          I worry from the post and the comment above that people still have the mistaken view that evolution is progressive, in that it has directions and end-points.

          Nothing could be more wrong.

          Natural selection as envisaged by Darwin is just a shorthand we use to describe the intreraction between heritable variation and the environment given a superabundance of progeny. It is all too easy to give natural selection a ‘personality’ like Death with his scythe. But natural selection has no wisdom, it has no foresight, it has no plan, it has no direction, and it has no memory. Any trends we read into evolution are ours to make, after the fact, and may reflect our own prejudices as well as what’s really out there.

        • Date:
          Friday, 07 Dec 2007 - 04:00 GMT
          Pam Richards said:

          I would love to read your work relating to that last question. Without ‘natural’ or ‘chosen’ selection, we would not have our famous companion doggie pets. Therein lies the reason for humans thinking they are the final species, the grand finale,the jewel in the crown. Evolution cannot BE evolution unless it covers EVERTYHING in the largest sense of the that word. Does anyone else ever wonder what the Neanderthal “thought” about it and what they thought of Homo Sapien, or what the next issue of “humanity” will believe our species “thought” about it? I do. It’s fun to find out where other people are in this grand game.
          Maybe you can utilize words to “describe” something “felt” and I would like to read them.


Search blogs

web feed Want a blog?

Submit this post to

Advertisement