The first day highlighted scientists from Harvard, while the second day featured outside experts. Scientists from many diverse disciplines (astronomy, chemistry, biology, geology, etc) converged to discuss topics ranging from how to find other potentially habitable planets (Sara Seager, MIT) , to discussions and experiments aimed at giving us a better idea how life’s first precursors and polymers may have formed, replicated, or even become encapsulated .

For me, some of the highlights included Jack Szostak’s (Harvard) discussions of replicating vesicles (models for early cells or cell divisions), and Gerald Joyce’s (Scripps) work on RNA ribozymes (as a model for simple self-replicating systems).

Immersed in a sea of scientists, I was somewhat surprised to see a priest walk by me toward the end of the conference. I guess he probably spends a lot of time thinking about the origins of life too.

There I saw a talk by one of my former PhD graduate committee members, Jim Liao (UCLA), who talked about his recent work focusing on reengineering the bacterium E. coli to produce butanol from simple sugars.

It’s quite astounding the possibilities that abound when you realize the potential that genetic engineering and synthetic biology provide. Engineering new pathways in microorganisms has come a long way and continues to make great strides in applications ranging from biofuels to medicine.

I’m glad that funding agencies (both private and public) are now taking a more active role in funding sustainable and renewable bioenergy research projects in this time of needed innovation.

Here’s also a nice article about the Microbial Science Initiative: The Undiscovered Planet, Harvard Magazine 2007

While most scientists at large research universities have institutional subscriptions to many journals, and therefore don’t have to pay extra fees to download individual articles, the majority of the general public does not have this same type of access due to the somewhat high costs associated with institutional and personal journal subscriptions.

In the day of google and wikipedia, individuals are becoming less reliant on “experts” relaying information to them, and are instead investigating and researching questions themselves, with the help of their trusted computer. While individuals can get much useful information from internet search sites and web-based encyclopedias, why should they also not be able to read the latest full-length, peer-reviewed scientific articles, without the fear of going broke pursuing their natural curiosity?

For instance, why should a newly-diagnosed cancer patient be economically discouraged from reading the latest scientific research regarding their certain type of cancer, due to the high costs of electronic reprints?

or

Why shouldn’t a high school student be encouraged to download 5 recent papers related to a particular scientific topic for a mere fee of $1 each? Something that would surely be cost prohibitive at a cost of $10 to $30 each.

Research is published in hundreds, if not thousands, of diverse journals, making personal subscriptions to all of these extremely cost prohibitive to someone in the general public, and the fee for individual scientific article reprints too costly at this time I believe.

To address this need, I’d like for someone to develop (with the publishers) an easily searchable database (in the vein of NCBI’s PubMed), that not only allowed users to freely search and identify relevant scientific articles, but also allowed users to download complete electronic reprints of the articles for $1 or less. Such a model has worked well in the music industry (case in point Apple iTunes) and I sincerely believe that such a model could greatly expand the reach of science in both the worldwide scientific community as well as the general public at large.

Journals may at first be wary of such a proposal, envisioning shrinking profit margins and unsustainable models, but I believe that if the price of scientific reprints were decreased to $1, a model of high price/small market would be gradually replaced with a model of low price/larger market. It’s important for all of us to maintain the journals economic strength and viability, since they are the main source we use to share our scientific work with others, as well as for us to learn about the most current research.

Another complementary model I support, adopted by the open access journals, is to make all articles free of charge, supplemented by author fees or outside grants. Such models are complementary to the $1 reprint, since the end goal is to make scientific literature more accessible to a wider audience. Some journals will thrive under the open access model, while others may need a continued revenue source to maintain viability, but in the end it is important to decrease the fees for scientific reprints to a nominal fee.

I look forward to the day, where anyone can sit down at their computer and download any scientific article for $1 or less.

Bacteria have been evolving for billions of years, so it should not be surprising to us that they continue to evolve in modern times. The same selective forces that have helped bacteria adapt to particular niches and environments are now enabling bacteria to become resistant to drugs and antibiotics at a disturbing rate. Add to that, the challenge, cost, and time involved in identifying new drugs and new drug targets, and this problem becomes even more worrisome.

Such cases have emphasized the need to develop faster and better methods to identify new and more effective drugs, alternative strategies to fight bacterial and viral diseases, and better vaccine platforms. In some cases we must rethink traditional methods of fighting disease if we really want to keep up with the readily evolving drug resistant strains.

Presently, more than 2 million people die from tuberculosis each year. Many of these cases are in countries where they do not have adequate access to costly drugs. I hope in the coming years that academic labs, biotech companies, and pharmaceutical companies can pull together to work toward better solutions for combating disease at home and abroad. At home, the challenge will be to deal with emerging multi-drug resistant strains, and abroad the challenge will be to make drugs cheap enough so that all who need these drugs will get them, no matter the economic background. These are worldwide problems that need worldwide solutions.

It was a great show, and I really have to give it up for the second year HMS and HSDM students. They really put in a lot of effort and did a great job.

This year’s show titled “Joseph Martin and the Amazing Technicolor White Coat”, featured a cast of students parodying select HMS professors (all in fun), who by day seemed to be mild-mannered professors, but when a dire situation arose on stage, they donned their spandex-superhero costumes to battle the diseases that be. The characters ranged from Captain Tight Junctions to Joseph “Dean” Martin.

Some of the notable performances included the over-eager surgeons-to-be, the cast of students playing diseases (ranging from TB to Staph), M&M (the rapping Morbidity and Mortality antagonist), and of course the HMS superheroes.

The show also featured musical and dance numbers throughout, many of which centered on science, medicine, or curriculum reform. With lyrics like the following how could you not love the show:

“Look at this bench,
Isn’t it grand?
Wouldn’t you want a pipette in your hand?”

The show was fun, and I would recommend next years show to anyone living in the Boston area, particularly if you work in science or medicine.

The seminar at MIT was not your traditional seminar by any means, but instead featured Dr. Collins discussing his faith, of all things, within the context of his work. It was part of the Veritas Forum at MIT, discussing Science, Faith, and Technology. I had not been to a seminar like this before.

There were many topics discussed that I will not go into, but one in particular that I did appreciate. It was a discussion of the overwhelming evidence that evolution happens.

Somewhere along the line, evolution became a bad word to many religions. In turn, it has closed many people’s minds, and created an unnecessary anxiety that if evolution happens then maybe certain religious foundations would crumble. I appreciated that Francis Collins, in his own way, was trying to help others understand that, yes, evolution does happen, that there is overwhelming evidence that evolution happens, and, yes, evolution has shaped all life forms on earth, including ourselves.

As I said in my first blog:
ATGATTAACTCCTGTATAGAAAATTGTGAAGCCAGGGAGACCCATGAAG
CAAATTCATGGGAGAGATCGTGA
Translated: In Science are the Answers

I personally think the study of evolution is one of the most fascinating areas of science, and with the abundance of genomes now available, we can really begin to better probe how life evolved at the molecular, cellular, and organismal level.

The last question of the night from the audience, was the best question of all. If life has been evolving for billions of years, why do we think that we (humans) are the endpoint?

I started writing a book on this question today.

I would spend hours a day rummaging through discarded boxes, looking for things to either take apart or to use in my latest series of “inventions”. I’m not exactly sure what I was trying to “invent” at any certain point of time, but I made my fair share of electromagnets and exploding rockets as a kid. I was always fascinated by the methodology of invention.

In my makeshift garage lab I spent countless hours taking apart discarded appliances for parts and I always tried to figure out how these things worked in the process. I’m not sure what my parents thought of all of this, but as long as I kept my hands off the working appliances in the house they let me do my thing. I sometimes would recruit my friends to help me in these endeavors, but for the most part it was just me and my garage. I loved the freedom I had to think on my own, and would not trade this time for anything in the world. It really had a prominent impact on the person I am today.

Well, as time went on; some of these activities got me into trouble. One of my friends burned down some trees next to his house with the homemade rockets and I got in trouble for selling small exploding capsules at school, but for the most part, the risk was worth the reward.

Unfortunately, as I went through school, I soon learned that creativity wasn’t fostered to the extent I would have liked. In many classes, teachers seemed to reward rote memorization instead of challenging us to think for ourselves. Luckily, this did not sway me from my interests in the sciences and math. In addition to finding these subjects fascinating, I already knew about Edison and other inventors, and knew in my own mind what is must be like to be a scientist.

Throughout the years, from grade school to high school, I always had the sanctuary of my garage to pursue my creative interests, whether it was creating makeshift devices, playing music, painting, or just thinking.

In college, I appreciated the fact that the creative process was highly recognized in science instruction as well as in art instruction. In science, creativity is essential to “discover” the fundamental principles of life, where in art this creativity is often used to “reflect” on the fundamental principles of life. I still paint in my spare time, but my passion, and most of my time is spent trying to better understand “how life works” at the molecular level.

I have since left the days of retreating into the solace of my garage, and now I pursue my questions and interests in a research lab. Sometimes when I’m sitting in front of my computer, or working at my lab bench, I think of the old days where I only dreamed of having a job like this.

I arrived last Thursday (Nov 9) with no place to stay and spent the next 48 hours scouring the Harvard Medical School off-campus housing website and craigslist for a place to live. I hadn’t yet figured out all the bus, subway, and shuttle routes so I figured, to play it safe, I had better find a place somewhat close to my new postdoc lab. After dozens of calls, emails, and some frustration, I finally found a nice place to call home. The best part is that it is only a short walk to my new lab in the Longwood Medical area. Mission 1 accomplished (although I have yet to find an equally convenient place to park my car).

Mission 2: Getting settled into the new lab.

Starting in a new lab can yield many great unknowns prior to arriving such as: will the people in lab be immediately friendly to a new member, will I get to work on a project tied to my interests, how does the PI interact with the lab members, etc. Luckily for me, I did my research when looking for a lab to do my postdoctoral research in, and I chose a lab with, not only a great reputation for research, but also a lab that had a great working environment.

Since I arrived at the lab last Monday (Nov 13), I have been so happy with my decision. The people in the lab have been really great; telling me about their research projects, and some even inviting me to possibly participate in related projects (that is great!). My first meeting with the PI, since starting, was also terrific. He broke down the projects of the lab, the direction the lab was going, and recommended who I should talk with in the lab that may have similar research interests. The new ideas, the new collaborations, the new technologies; it’s really exciting!

Now all I need to know is where the best local pizza place is.

Much of Farmer’s work detailed in “Mountains Beyond Mountains” centers on the study and treatment of patients harboring the deadly M. tuberculosis pathogen. Worldwide, tuberculosis kills over two million individuals each year, and is often complicated by co-infections with AIDS. Sadly, many tuberculosis deaths occur in developing countries, or less-affluent countries, due in part from a disheartening variety of factors including the prohibitive cost or availability of medications in some countries.

At its core, “Mountains Beyond Mountains” details Farmer’s efforts to create a community-based medical clinic in the rural village of Cange, Haiti. Together, with local community members and PIH members, Farmer establishes Zanmi Lasante (Creole for Partners in Health), whose goal is to provide health care for all those in need, no matter the economic situation of the patient. Through his work at Zanmi Lasante, Farmer and his colleagues have been able to address important medical problems throughout the region, ranging from the treatment of AIDS patients to devising new strategies to better combat multi-drug resistant tuberculosis cases.

There are many reasons I would recommend this book, but most importantly “Mountains” reminds us of the economic challenges and disparities that still prevent millions of people from receiving adequate health care across the globe.

While the Wright’s achievement was remarkable in itself, it was equally impressive to contemplate the rapid acceleration of aviation breakthroughs that followed. Although mankind had dreamed about the possibility of flight for hundreds of years prior, it took less than 66 years to progress from the first flight in Kitty Hawk to the first manned mission to the moon. The floodgates were indeed opened.

There are many parallels to the current genomic revolution underway, starting with the discovery of the DNA double helix. We have gone from the cloning of individual genes, to the sequencing of entire genomes, to the cloning of entire organisms. It is exciting to think of the scientific breakthroughs yet to come, each of which will undoubtedly help us better understand the underlying molecular blueprint of life.

ATGATTAACTCCTGTATAGAAAATTGTGAAGCCAGGGAGACCCATGAAG
CAAATTCATGGGAGAGATCGTGA